Friday, 19 June 2009

DNA-encrypted recipes

This morning I woke up with an idea for a science education/outreach project in my head. The idea is borne out of a fun exchange on twitter yesterday which occurred at the tail end of a long series of frustrated tweets about some problems I'm having submitting DNA sequences to Genbank:
kejames: Perhaps I should just tweet the sequences to Genbank: ctagctgctgttgaagttccatctataaatggataagactttggtcttagtatatacgagttctt

TwistedBacteria: chloroplast Prunus laurocerasus (cherry laurel) RT @kejames: Perhaps I should just tweet the sequences to Genbank: ctagctgctgttgaagttccatcta
That's right, TwistedBacteria actually thought to take my DNA fragment - tweeted in a moment of pure, hands-thrown-in-air frustration - and see if he could identify what species the fragment came from. What he did is essentially DNA barcoding (but using Genbank instead of the voucher-specimen-linked BARCODE-tagged databases 'approved' by CBOL).

The really cool thing is that even though I tweeted such a short sequence (just 83bp), and even though I had copied that sequence from a randomly chosen place in my data set, TwistedBacteria's correctly identified the genus if not the species of my specimen; the fragment I tweeted is from blackthorn (Prunus spinosa), not cherry laurel (Prunus laurocerasus).

It was entirely by accident that I happened to choose a blackthorn sequence to tweet, but because I did, I was reminded of a little haiku I did for the Science Creative Quarterly a while back:

a haiku by Karen James

Prunus spinosa
Juniperus communis
Triticum sp.

And that's when the idea hit me: why not take this 'recipe' one step further and make a fun and educational puzzle out of it by leaving the title of the recipe blank and encrypting the ingredients as DNA sequences? And why not do this for a bunch of recipes and make a whole DNA-encrypted recipe book? Here's what my sloe gin recipe might look DNA-encrypted:

The following ingredients make up what alcoholic beverage?

One could mix it up a bit and use some amino acid sequences too, and for ingredients that are pure products of biochemical pathways (sugar, alcohol, etc.), one could use sequences of genes that function in those pathways.

Lessons would include:
  • our food is (or was, or was produced by) living organisms with DNA in them (this is an important lesson - I've heard that children are generally unaware that what they ate for breakfast consisted of plants and animals)
  • you can identify species by their DNA
  • genes encode proteins, which have functions in the cells of plants and animals
  • practice using Genbank and BOLD databases
So, what do you think?

Eric Heupel said...

Briliant! I love it. Johann really enjoys learning through exploratory mysteries like this. (Keeps Tammy on her toes!)

Richard Carter, FCD said...

Sorry, this is too nerdish, even for me.

Ah, Triticum sp.! Takes me back. Featured prominently in my Scientific Techniques in Archaeology dissertation back in '86.

Miriam Goldstein said...

Yes, teach the children to make gin! :)

Karen James said...

Well, Isabella Rossellini's Green Porno makes science sexy-like, so I figure why not make science saucy-like!

César Sánchez said...

Interesting! I was thinking of ways of making the clues more specific (for instance, by using perhaps sequences from small rRNA?) and trying to keep the clues as short as possible (using shorter sequences). But then I thought that perhaps non-specific clues (that is, leading to the right genus but not defining species) could be more fun. You could even insert short stretches of nucleotides/amino acids containing extra information (either to help solve the puzzle or just for fun). Biological sequences offer immense possibilities for procrastination...

joe dunckley said...

i have two words for you: pub and quiz.

Panic Away said...

Quite a tweet! It's fantastic. What Eric said is right - it does keep you on your toes!