DNA-encrypted recipes

This morning I woke up with an idea for a science education/outreach project in my head. The idea is borne out of a fun exchange on twitter yesterday which occurred at the tail end of a long series of frustrated tweets about some problems I'm having submitting DNA sequences to Genbank:

kejames: Perhaps I should just tweet the sequences to Genbank: ctagctgctgttgaagttccatctataaatggataagactttggtcttagtatatacgagttctt
gaaagtaaaggaacaata

TwistedBacteria: chloroplast Prunus laurocerasus (cherry laurel) RT @kejames: Perhaps I should just tweet the sequences to Genbank: ctagctgctgttgaagttccatcta

That's right, TwistedBacteria actually thought to take my DNA fragment - tweeted in a moment of pure, hands-thrown-in-air frustration - and see if he could identify what species the fragment came from. What he did is essentially DNA barcoding (but using Genbank instead of the voucher-specimen-linked BARCODE-tagged databases 'approved' by CBOL).

The really cool thing is that even though I tweeted such a short sequence (just 83bp), and even though I had copied that sequence from a randomly chosen place in my data set, TwistedBacteria's correctly identified the genus if not the species of my specimen; the fragment I tweeted is from blackthorn (Prunus spinosa), not cherry laurel (Prunus laurocerasus).

It was entirely by accident that I happened to choose a blackthorn sequence to tweet, but because I did, I was reminded of a little haiku I did for the Science Creative Quarterly a while back:

SLOE GIN INGREDIENTS
a haiku by Karen James

Prunus spinosa
Juniperus communis
Triticum sp.

And that's when the idea hit me: why not take this 'recipe' one step further and make a fun and educational puzzle out of it by leaving the title of the recipe blank and encrypting the ingredients as DNA sequences? And why not do this for a bunch of recipes and make a whole DNA-encrypted recipe book? Here's what my sloe gin recipe might look DNA-encrypted:

The following ingredients make up what alcoholic beverage?

gcacaggctgaaacaggtgaaatcaaagggcattacttgaacgctactgcaggtacatgcgaagagatgatgaa
aagagctgcatttgccagagaattgggggttcctatcgtaatgcatgattacttaacagggggattcactgcaaata
ctaccttggctcattattgccgagataatggtttacttcttcacatccaccgtgcaatgcatgcagttattgatagaca
gaagaatcatggtatgcactttcgtgtactagctaaagcgttacgtatgtctggtggagatcatatacacgctggtac

ggatgtactatcaaaccaaaattgggtctatctgccaagaattatggtagagcggtttatgaatgtctccgtggtgga
cttgattttaccaaggatgatgaaaacgtgaattcccaaccatttatgcgctggagagatcgtttctgcttttgtgcag
aagcactttataaagctcaggctgagacgggtgagattaagggacattacctgaatgcgactgcagggacatgtga
agaaatgatgaaaagagcagtattcgccagagaattgggagttcctatagtcatgcatgactatctgactggaggtt

aagaaatgattaagagagctgtatttgcaagagaattaggggttcctattgtaatgcatgactacttaactggggga
ttcaccgcaaatactactttggctcattattgccgcgacaatggcctacttcttcacattcaccgtgcaatgcatgcagt
tattgatagacagaaaaatcatggtatgcatttccgtgtattagctaaagcattgcgtatgtctgggggagatcatatc
cactccggtacagtagtaggtaagttagaaggggaacgcgaaatgactttaggttttgttgatttattgcgcgatgatt

One could mix it up a bit and use some amino acid sequences too, and for ingredients that are pure products of biochemical pathways (sugar, alcohol, etc.), one could use sequences of genes that function in those pathways.

Lessons would include:

• our food is (or was, or was produced by) living organisms with DNA in them (this is an important lesson - I've heard that children are generally unaware that what they ate for breakfast consisted of plants and animals)
• you can identify species by their DNA
• genes encode proteins, which have functions in the cells of plants and animals
  
• practice using Genbank and BOLD databases

So, what do you think?

On my honour, I will try (3/4)

This is the third post in a four-part series, begun over on the Beagle Project Blog in Part 1 (which includes an introduction to The Science Scouts) and Part 2.

Here is the third batch of my Order of the Science Scouts of Exemplary Repute and Above Average Physique badges:

The "I've done science with no conceivable practical application" badge. Well, maybe I lack imagination but I simply cannot conceive of a practical application that might come from an understanding of the evolutionary mechanism of interspecific variation in fruit fly eggshell morphology. The whole point was to understand evolution just a little bit better, and to me that is enough to make it worthwhile. That said, science for curiosity's sake also sometimes leads to practical applications that are only as yet inconceivable but may very well become earth shatteringly important at some later stage. For example, there's the story of that guy who was fascinated by the mold spores that landed on his petri dish (inconceivable!) but then it turned out to be the source of Penicillin. 'Nough said.

The "science has forced me to seek medical attention" badge. More people can claim this badge than probably realise it, especially if we count mental health, which I think we should. I get the badge for a number of reasons: 1) repetitive strain injury, numbness in my right hand and a strained muscle in my neck, all from writing my thesis, 2) astigmatism partly due to looking through a microscope for too many hours per day in grad school and 3) Temperomandibular joint disorder (TMJ) from PhD related stress.

The "somewhat confused as to what scientific field I actually belong to" badge. This badge was made for me. During my PhD I moved from developmental genetics to evo-devo. Now it's even more pronounced; you see, sometimes a geneticist can feel rather alone in a natural history museum. For example, whenever I meet a new member of staff or visitor, the question always comes up, "so, what group of plants do you work on?" Me: "Uh, um, well, see, I work on genetics/genomics as they apply to just about any group of plants." Them: "oh" *walks away*. It turns out that when one's "specialty" is (or was) Drosophila melanogaster, that doesn't seem to count. Sometimes this transdisciplinary thing isn't all it's cracked up to be. Oh well, it seems to be working out okay.

The "works with acids" badge. Two words: deoxyribonucleic acid. Then there are all the other acids which come with working in any wet lab. I won't bore you with the details. They really are boring. Really.

One batch of badges to go! Sneak preview in the sidebar.