'Impact' crater

Tonight I attended the twitter-inspired 'Blue skies ahead?' debate in which science minister Lord Paul Drayson gamely engaged a youthful panel (and audience) of scientists on 'the prospects for UK science'.

The first half of the debate was dominated by one word: 'impact'. It's an unfortunate word choice, really: it's vague, loaded and unidirectional, suggesting science impacts society but not the other way around. There was lively disagreement regarding the extent to which science funding should hinge on retrospective and/or predicted impact.

As evidenced by my flush of tweets during and after the event, I have a lot to say about 'impact', but in this post I'm going to set aside my opinions and instead tell a personal story of how 'impact' impacted me.

I wouldn't have thought to tell this story (it happened a while ago and as it has a happy ending I don't give it too much thought anymore), but after two respected tweeps, Ed Yong and Evidence Matters, specifically asked for it, I thought it might merit daylight.

In 2002, shiny new PhD in hand, I was looking for a job in the UK. I was casting a wide net, applying and interviewing for not only postdoctoral research positions but also assistant editorships at peer-reviewed journals and various jobs involving popular science communication. During my PhD years, I had enjoyed writing and communicating science to both expert and non-expert audiences, and moreover I think it is a scientist's civic duty to engage the broader public, to improve general science literacy but also to pave the way for future science funding.

One of the postdoc fellowships for which I interviewed seemed perfect; the project addressed some fascinating evolutionary developmental-genetic questions using a range of new and old techniques, the lab seemed like it was thriving, and the lab head had written books and popular science articles which I not only admired but which also suggested that he might be a good mentor for that element of my training.

My interview seemed to go very well: my CV was strong, I was happy with my presentation, I had good discussions with the lab head and the other members of the lab during which I asked questions, made suggestions and I even proposed an experiment that it turned out they hadn't thought of yet.

At one point during my interview, I mentioned how keen I was to stay active in public outreach, through writing and perhaps other forms of engagement, and that I admired his own accomplishments in that area.

And that's where it all went wrong. In a sudden change of tone, the lab head started asking me probing questions about my commitment to the project, suggesting that I might not be up to seeing it through. He said I might be more suited to a career as a journal editor or science communicator. I reiterated my commitment to the research project, and said that I thought that shouldn't preclude engagement with the wider public; indeed, his own success in both research and popular science writing showed that it was possible to do both, and to do them well.

But it was too late. He had made up his mind. He wanted the people in his lab to have their noses to the research grindstone; he saw public outreach as icing on the cake, something you did only once you'd achieved success in your research career and were running your own lab.

Sure enough, a few weeks later he emailed me to say he'd decided to give the job to someone else. He cited his concern about my 'level of interest and commitment to the project', repeating a phrase he had used the day of the interview after I'd divulged my sordid secret interest in improving public understanding of science.

For a while I had some regret, but then I came to realize that it was better this way. I'm glad I didn't go to his lab only to find out too late that my 'extra-curricular' interests wouldn't be looked upon favorably.

Ultimately I found a job at an institution with a genuine commitment to both scientific research and public engagement with science. There will always be a natural tension between the two - after all, there are only so many hours in the day and science is a demanding career - but I'm glad to be in a place where public outreach isn't considered a character flaw.

Coming back to the 'Blue skies ahead' debate, I hope my story illustrates what every research scientist already knows: career progression depends primarily on one's (peer-reviewed) publication record and, to a lesser extent, one's history of winning research grants. Anything that takes time away from these two activities is therefore by definition a drag on one's career. Many of us do it anyways, because we enjoy it and think it's important. But there will not be any significant increase in the number of scientists engaging in public outreach until recognition of these activities is incorporated into research career progression criteria.

My first mix on 8tracks

8tracks is a simple way to share music mixes online. Here's my first attempt:

I love the NHS but not their Ramadan health FAQs

The health care debate taking place in my homeland right now is immensely important. The outcome will affect all 300 million Americans, especially the 46 million that are uninsured, and if reform doesn't pass now, we probably won't get another shot at it for another decade or two.

It's also important to me, personally, as I do hope to repatriate one day. I am absolutely pro-reform and I find two aspects of the debate particularly infuriating:

1. the spread of outright lies about the proposed reforms by the small but very screechy anti-reform camp (debunked here), including the slinging of vast quantities of mud across the Atlantic at the UK's National Health Service
2. the sheer number of Americans--64%--who 'don't want to pay more taxes to expand health coverage to the uninsured'

As an American living in the UK, I feel it is my particular duty to counter the misinformation about the NHS that is circulating in the States right now. I've been counter-circulating as much information and testimonials by email and facebook as I can, and even have an 'I [heart] NHS' twibbon on my twitter avatar as a sign of my support.

I do, by the way. [Heart] the NHS, that is. It is difficult to overemphasize the peace of mind it gives me that those I love and I will never be unexpectedly refused coverage as a result of some policy small print about, for example, pre-existing conditions, nor financially ruined by a health problem. What a relief it is to be able to go to the doctor without having to fill out any forms or make any co-payments. Oh, and prescriptions are either free or £6.95 depending on whether you are capable of paying. I could go on but that's not what this post is about, and others have said it much better than me.

This post is about something the NHS did that has me pretty irked. I know, I know, given all of the above, maybe now isn't the best time to point out flaws in the NHS, but to that I say: a) this flaw has nothing to do with the general premise of the NHS or the health care they provide and b) I think it's right to be honest even when it's not politically expedient. Ahem.

So. The NHS has this website called 'Healthy Ramadan' which offers advice on staying healthy if you happen to have chosen to observe the daylight fasting that is part of the Muslim holy month of Ramadan. Of course, the word 'chosen' is tricky because it's difficult to quantify the extent to which religious indoctrination limits one's perceived if not real choices, but I digress.

The site seems like a pretty good idea: there are pages containing general advice on healthy fasting, suggestions on what to eat and what not to eat, and even a suggested meal plan. There's also an important section that lists the health risks that can be associated with fasting, and the site urges people to use Ramadan as an opportunity to quit smoking.

But then we get to the page, 'Ramadan health FAQs'. This page got my hackles up immediately with its introductory note that explains that 'the answers have been put together by medical experts and Islamic scholars and researchers'. I can see why Islamic scholars and researchers might help with devising the questions - after all, they are the experts on what the likely FAQs are going to be. But why should they be involved with putting together the answers? This is supposed to be health advice. It should come from the medical experts alone.

The first several Q&As about diabetes, migraines and blood pressure were okay, I suppose, though I was a little uncomfortable with how the questions were worded: each one was based around the question, 'should I fast?' when they really should have asked, 'is it alright to fast?' because then the answer would be less likely to be interpreted as prescriptive rather than permissive. But then I got to this one:

Is fasting harmful when a woman is expecting a baby? Must pregnant women fast?

There's medical evidence to show that fasting in pregnancy is not a good idea. If a pregnant woman feels strong and healthy enough to fast, especially during the early part of the pregnancy, she may do so. If she doesn't feel well enough to fast, Islamic law gives her clear permission not to fast, and to make up the missed fasts later. If she is unable to do this, she must perform fidyah (a method of compensation for a missed act of worship).

Let's just start with the question, shall we? 'Must' should never appear in front of or inside the phrase 'pregnant women fast', and certainly not on a national health service website. In fact the only time those two phrases should ever go together on any kind of government literature is if 'not' is inserted directly after 'must'.

The answer to the question starts out a bit better--using 'may' instead of 'must'--but then it all goes downhill. 'Islamic law gives her permission not to fast...' is useful information, as it may give uncertain women the religious argument they are looking for to give themselves permission not to fast (though of course that opens up a whole can of worms that I'm not going to go into today). But that last sentence is abhorrent. It's missing a big fat 'Islamic law says' before 'she must'. The way it is now, it looks like the NHS is the one telling her that she must perform fidyah!

I suppose one could argue that 'Islamic law' is mentioned in the penultimate sentence and therefore it is meant to indicate that Islamic law, and not the medical establishment, is the authority in both of the final two sentences. And I suppose that if this were the only problem with the website then I might have given them the benefit of the doubt. But two questions later it gets worse, and this time there's no qualifying 'Islamic law says' anywhere to be found:

From what age can children fast safely?

Children are required to fast from the age of puberty. It isn't harmful. Fasting before this age is tolerated differently depending on the child’s general health, nutrition and attitude. Fasting under the age of seven or eight isn't advisable. It is a good idea to make children aware of the practice of fasting and to practise fasting for a few hours at a time.

Look at that first sentence and tell me the NHS--the NHS!--didn't just say that children are required to fast during Ramadan!

The next few Q&As are okay, I suppose. They're about asthma, swimming and blood transfusions and there are occasional qualifiers like 'Muslim experts say...' and 'in their view...'. But I don't like how the answer to the asthma question contains an implication that it's somehow incumbent on Muslims to 'achieve good control' of their asthma ...as if it's some kind of personal failing if your asthma isn't under control. And I don't like that the answer to the transfusion question mandates fidyah with no qualifiers in sight. But I'm passing over these so that I can address this final doozie:

Does a breastfeeding woman have to fast?

No. Islamic law says a breastfeeding mother does not have to fast. Missed fasts must be compensated for by fasting or fidyah once breastfeeding has stopped.

As with the Q&A about pregnancy, the question itself contains an implication that the answer is mandataory rather than permissive. And again, missed fasts 'must' be compensated, no qualifiers, unless you count the one in the first sentence, but at this stage I'm not exactly inclined to give them a pass.

So, all you NHS web content editors out there, would you please do us all a favor and go in there with a red pen and change 'must' and 'should' to 'can' and 'could'? And while you're at it, add a liberal sprinkling of 'Muslim scholars say...' and 'Islamic law says...' before each sentence in which fasting is 'permitted' or fidyah 'suggested'? Oh, and could you please pay particular attention to those Q&As regarding women and children? Because I've noticed that those were most prescriptive and least qualified of all.

I'd do it myself, but I'm hungry.

Saved by Science (NHM) Photo Series

I'm now six installments into a twitter photo series I've been calling "Saved by Science (NHM)" and I've decided I'm enjoying myself enough to warrant formalizing it a bit more.

It all started when I was browsing SEED magazine's special Darwin bicentenary collection (as a professional Darwin groupie is wont to do) and saw a link to an article by Carl Zimmer called 'The Awe of Natural History Collections'. I clicked it (as an Natural History Museum employee is wont to do) and was immediately enthralled, from the subtitle--'visiting the hidden side of natural history museums, where the vast collections of scientific specimens are kept'--through to the end. It's a real Zimmer gem, if you ask me.

Anyways, the article links to an audio slide show by Justine Cooper called "Saved by Science". It's not your average window-dressing to an article, it absolutely steals the show. And considering how good Carl Zimmer's writing is, that's really saying something. It's a brilliant piece of stand-alone journalism. Some of the slides are astonishingly intimate and poignant. Go there now and watch (and listen to) the whole thing.

I was immediately struck by the familiarity of the photographs. They were so similar to scenes I'd witnessed myself at the Natural History Museum in London, where I work. And then I realized that there was a communication void just waiting to be filled; I realized that I really should start taking candid behind-the-scenes photos at 'my' museum along the same lines as Justine Cooper's photos of AMNH.

And so began "Saved by Science (NHM)", a series of tweets (1, 2, 3, 4, 5, 6...) with my Cooperesque NHM photos attached as twitpics. Of course, my photos are usually taken with my iPhone, not a large-format camera, and of course they're not nearly as good as Cooper's, but the point is to reveal the hidden side of the Natural History Museum to a wider audience.

To keep up on my series you can follow me on twitter, but as twitter is a pretty ephemeral thing, and as not everyone tweets (I know--shocking), and as I'd hate for the series to get lost in that ever-growing graveyard of old, unarchived tweets, I've created a permanent archive on my website.

Gene angst: finding a DNA barcode for plants

I've been incubating this post since September 2008, so it's kind of cathartic to finally be writing it. I think it will be a good representation of the title and purpose of this blog in the sense that it's a window to some of those things that go on in science - and in the lives of scientists - that don't make it into the peer-reviewed publications.

So why the wait? On top of that it's inappropriate to talk in public about a piece of research before it's published unless all your co-authors agree (and a quick peek at the number of co-authors on this paper will explain why that was a non-starter), this work involved a lot of personalities and politics - even more than the usual paper - and some rather sensitive discussions and debates were being had right up to the publication date.

Speaking of the publication date, you'd be forgiven for thinking this open access PNAS paper came out on Tuesday; there was, after all, a rash of online and print news items¹ and press releases² about the paper that day, even radio and television interviews. But the paper wasn't published in the Early Edition until Thursday. See, PNAS does this weird thing where they lift the press embargoes on all of the papers in each week's issue on Monday night, even though the papers themselves may come out any day that week. I'm not sure why they do this and I find it a little annoying, largely because though we see a flood of news about a paper on Tuesday, it isn't actually available to non-journalists - you know, like those scientist and taxpayer schmucks - until a few days later. The result is that by the time the paper is out it's too late to influence or even critically filter any of the media surrounding it.

But I digress.

'A DNA barcode for land plants' is the culmination of 4 years' blood, sweat and tears work by a global consortium of researchers called the Plant Working Group (PWG) of the Consortium for the Barcode of Life (CBOL).

The purpose of the PWG is to bring plants up to speed with animals in an international effort to build standardised reference libraries of DNA sequences from known and unknown species. These libraries of 'DNA barcodes' will ultimately enable the rapid identification of unknown specimens (or fragments of specimens) even by non-experts. In the meantime the collaborations and frameworks created to build the libraries will, in the words of John F. Kennedy from his famous "We choose to go to the Moon" speech, "serve to organize and measure the best of our energies and skills."

Because I've blogged about DNA barcoding several times before³, both here and on The Beagle Project Blog, I'm not going to give you a lengthy background on barcoding in this post. Rather, I'll explain briefly why plants needed bringing up to speed in the first place, but then move on quickly to how we did it, and what it was like to be involved.

Why have plants lagged behind animals in terms of amassing DNA barcode reference libraries? It's not that botanists aren't keen to participate. Rather, it's that the gene chosen (and officially endorsed by CBOL and therefore GenBank) to serve as the DNA barcode for animals, CO1, though present in plants, is not variable enough to use in species identification. So the search was on for a CO1 equivalent in plants: a region conserved enough through evolution to be found in and easily amplified from every plant's genome but carrying enough variation to distinguish species.

The approach CBOL took to finding such a region was to assemble a consortium of botanists actively working on DNA barcoding, and to pay for them to have meetings with each other in order to hash it out amongst themselves. As someone working on DNA barcoding plants at the Natural History Museum, I was invited - along with several others - to join in.

This was my first time as a direct participant in science-by-consortium and boy, was it an eye-opener. It turns out trying to get scientists - botanists no less (eek!) - to agree on something is not as easy as one might imagine. (There is a long and inglorious history of botanists disagreeing, but I've already indulged in one digression today...)

The PWG has met several times, most notably at a side meeting during the 2nd International Barcode of Life conference in Taipei in September 2007, and then again at the Royal Botanical Garden Edinburgh in September 2008.

The Taipei meeting was widely believed and reported to be something of a mess, with lots of claim-staking but not much progress towards the all-important Final Decision. I vividly remember one moment from the meeting in which we used a white board to list all of the candidate plant barcode regions (and combinations of regions). I photographed the white board (right). Looking back at it now, I think this picture speaks a thousand words with regard to the indecision that was left hanging in the air after Taipei.

The Edinburgh meeting, on the other hand, was more focused, with a mandate to have a decision made before everyone went home. Ably chaired by Pete Hollingsworth, head of the Genetics and Conservation section at the Garden, we spent two days (rather than two hours, as in Taipei) focused on the task.

I can't speak for anyone else, but I personally found the Edinburgh meeting to be a whole lot of fun. In essence, we - 15 plant DNA barcoding specialists from around the world - locked ourselves in a small room and agreed not to come out until we had made a decision. Coffee was administered by IV drip and snacks and sandwiches delivered to an adjacent room for when our brains ran out of ATP. Unlike the Taipei meeting, we had lots of data to hand in Edinburgh. Print-outs of spreadsheets and figures flew around the room like so much confetti and got annotated by hand as they were discussed.

Participants of the Plant Working Group meeting in Edinburgh emerged breifly from their self-confinement for a group photo.

I mentioned data. Our group from the Natural History Museum in London contributed amplification success rates and DNA sequences for six regions from 138 flowering-plant specimens. These specimens were collected during our project to repeat Darwin's botanical survey of Great Pucklands Meadow at Down House (pause for one of those 'oh if Darwin only knew about DNA' moments). This might seem like an impressive amount of data but in fact it was a modest contribution; some of the other groups contributed not hundreds but thousands of sequences. All in all the various research groups contributed data from 907 specimens from 550 species representing the major groups of land plants (including 670/445 angiosperm, 81/38 gymnosperm, and 156/67 cryptogam samples/species) for up to seven candidate regions that had been flagged in Taipei. These regions are, in no particular order, the genes rpoC1, rpoB, matK and rbcL and the inter-genic regions psbK-psbI, atpF-atpH and trnH-psbA.

Back to our little room in Edinburgh. In some cases we analyzed this mountain of data right then and there, and in other cases, as when there were gaps in our data set that still needed filling, we agreed to go back home and churn out those data pronto.

One of the more illuminating analyses we did was to compare how well all possible combinations of one, two, three and seven candidate regions performed in terms of discriminating species. We were (or at least I was) surprised to find that while increasing the number of regions used in combination from one to two improved the power of species discrimination, combinations of three or more weren't any better (right, Figure 1C from the paper).

In addition to discriminatory power, we also looked at practical issues like universality (i.e., the rate at which we were able to successfully amplify any given region from our collection of specimens) and sequence quality (e.g., the frequency of high-quality sequences obtained for each region, the amount of manual editing required and the concordence of bidirectional sequence reads).

Ultimately, after all of these analyses, there was no obvious winner, no gleaming silver bullet. And so began the war of attrition, during which we said our tearful goodbyes to certain regions that were okay in terms of universality and sequence quality, but pretty useless for species discrimination (as was the case for two regions, rpoC1 and rpoB), or good at species discrimination but with poor amplification success rates and sequence quality (as was the case for psbK-psbI).

After this weed-out process, we were left with three regions - two genes, matK and rbcL, and one intergenic spacer region, trnH-psbA. Though these three outperformed the rest none of them alone performed ideally for all three criteria.

At this stage there was an intense discussion about whether we should recommend all three as a combinatorial plant DNA barcode to CBOL, or just two of the three. Some in the group preferred the better-safe-than-sorry approach of a three-region barcode that could be pruned down to two at a later date if one of the three proved superfluous. The majority, however, thought a two-region barcode preferable because it would be both be less expensive in terms of sequencing costs and also because it was felt that we needed to be decisive; many would-be plant barcoding projects were being denied funding as a result of funding agencies fears that their money might be wasted if CBOL shifted the goalposts. Moreover, as I said above, though two regions are better than one at discriminating species, three are not better than two.

So of the three remaining regions, we tasked ourselves to decide which two in combination to recommend to CBOL as 'the' plant DNA barcode. It made sense to choose two regions which would complement each other: one with high universality and sequence quality and good, but not great discriminatory power (rbcL), the other with better discriminatory power but needing further technical work to improve universality (matK) or sequence quality (trnH-psbA). In the end, the group felt it was easier to overcome the universality difficulties posed by matK than the sequence quality difficulties posed by trnH-psbA.

And there we have it: the Plant Working Group recommends that CBOL adopt⁴ the combination of rbcL and matK as the official plant DNA barcode.

So that's the story of the scientific process that the Plant Working Group went through to select a DNA barcode for plants, but before I end I want to say a little bit more about the political and social process. If you read between the lines of my account here, you can probably guess that there were some intense disagreements between various members of the working group over how many, and which, regions to select. This begs the question, why would anyone care? It's supposed to be cold, hard, evidence-based science, right?

As PWG member Damon Little carefully said in his WNYC radio interview, '...when this started, a lot of people...[had] their favorite region for various reasons,...because they were the ones that discovered it or...because it was a region that had worked well for them in the past...' In other words, different research groups involved had to some extent pinned their reputations on certain candidate regions. As a result, they advocated those regions for a combination of political and historical reasons as well as scientific reasons.

But it wasn't all sorrow and strife. As you can imagine, after the workshop was over, there was a sense of relief and accomplishment - and for some, lingering frustration - and how better to mark the occasion than by refreshing ourselves at the Scotch Malt Whisky Society Vaults in Leith (right)?

And now we have finally come to my last bit of data in this blog post ...consider it supplementary data to Science Creative Quarterly's 'manuscript' entitled 'Scientists will geek out under any circumstances': at the Whisky Society, we were treated to PWG chariman Pete Hollingsworth's expert tutelage in whisky tasting. Here are some of the various drams we tried:

Whisky tasting with the Plant Working Group. Crop at right shows drams labeled by distillery (actually they don't tell you which distillery they're from, so these are actually Pete's guesses).

As is only natural, our conversation turned to DNA barcoding, and we noticed that, just as whiskies have thier own personalities, so do the plant barcode candidate regions. Moreover, we figured these personalities could be mapped onto one another...

rbcL=Highland Park, trnH-psbA=Longmorn, CO1=Laphroaig,
matK=Caol Ila and rpoC1=Glen something
...obviously.

...because that's what we humans do. We identify things, and we classify things. And I hope that the new plant DNA barcode helps us do that a wee dram better.

Reference:

CBOL Plant Working Group (2009). A DNA barcode for land plants Proceedings of the National Academy of Sciences of the United States of America, 106 (31), 12794-12797 : 10.1073/pnas.0905845106

Footnotes:

¹Notable press coverage (last updated Saturday, 1st August, 2009): BBC, CBC News (Canada), The Citizen (South Africa), Guelph Mercury, Science, Science Daily, Scientific American, The Scotsman, The Sydney Morning Herald, The Telegraph
²Press releases: Consortium for the Barcode of Life, Imperial College, Natural History Museum, Royal Botanical Gardens, Kew, University of Guelph
³Data Not Shown: Barcode of plants mapped identified tested; The Beagle Project Blog: Would that which we call a rose by a DNA barcode smell as sweet? and Arbor DNA
⁴Notice I wrote 'CBOL', not 'everyone'. This is because 1) the next step is for the PWG to submit a formal applicaiton to CBOL to have the two-region barcode approved (and this is important because CBOL alone can tell GenBank to rubber-stamp these two regions with the keyword 'BARCODE') but also 2) no matter what the PWG or CBOL says, individual researchers can always sequence whatever they want from whatever plant species they want, for whatever purposes they want. It's only if they want to participate in, and derive useful data from the international DNA barcoding effort, that this recommendation even matters.

'Man must explore'

At this very moment, exactly forty years ago, two men set foot upon the surface of the Moon.

The Moon, people!

There are many celebrations taking place 'in real life' and online; some of the most compelling of these are the real-time-plus-40-years commemorations like the Apollo 11 Radiocast, We Choose the Moon and ApolloPlus40.

As with all anniversaries (and boy, do I speak from experience), this is a time to reflect on the past and contemplate the future - in this case, of space exploration.

Almost as if to emphasize this, a review of the US Human Space Flight program is taking place right now, and they want our feedback. That's right: they want us rabble to tell them what we think about the future of manned missions into orbit and beyond.

So, here's what I think:

I think Apollo 15 Commander Dave Scott knew exactly what he was talking about when, upon becoming the 7th man to walk on the Moon, he said, "As I stand out here in the wonders of the unknown at Hadley, I sort of realize there’s a fundamental truth to our nature: man must explore. And this is exploration at its greatest."



I think that John F. Kennedy was absolutely right when, in his famous "we choose to go to the moon" speech, he said that we should go to the moon "because that goal will serve to organize and measure the best of our energies and skills...".

And I think that science and exploration are not just icing on a cultural cake to be undertaken during economically flush times, not just things we do to reap cold, hard, profitable benefits, but a core part of who we are as human beings.

As Brian Greene wrote in his brilliant NY Times Op-Ed piece 'Put a Little Science in Your Life', "science is a language of hope and inspiration, providing discoveries that fire the imagination and instill a sense of connection to our lives and our world. [snip] We must embark on a cultural shift that places science in its rightful place alongside music, art and literature as an indispensable part of what makes life worth living."

Update (21st July 12:15pm): I also think that people are holding science in general and the space program in particular to a double standard when it comes to federal funding. Have a look at Death and Taxes, an excellent and intuitive visualization of the federal budget. Is the NASA circle bigger or smaller than you expected?

DNA-encrypted recipes

This morning I woke up with an idea for a science education/outreach project in my head. The idea is borne out of a fun exchange on twitter yesterday which occurred at the tail end of a long series of frustrated tweets about some problems I'm having submitting DNA sequences to Genbank:

kejames: Perhaps I should just tweet the sequences to Genbank: ctagctgctgttgaagttccatctataaatggataagactttggtcttagtatatacgagttctt
gaaagtaaaggaacaata

TwistedBacteria: chloroplast Prunus laurocerasus (cherry laurel) RT @kejames: Perhaps I should just tweet the sequences to Genbank: ctagctgctgttgaagttccatcta

That's right, TwistedBacteria actually thought to take my DNA fragment - tweeted in a moment of pure, hands-thrown-in-air frustration - and see if he could identify what species the fragment came from. What he did is essentially DNA barcoding (but using Genbank instead of the voucher-specimen-linked BARCODE-tagged databases 'approved' by CBOL).

The really cool thing is that even though I tweeted such a short sequence (just 83bp), and even though I had copied that sequence from a randomly chosen place in my data set, TwistedBacteria's correctly identified the genus if not the species of my specimen; the fragment I tweeted is from blackthorn (Prunus spinosa), not cherry laurel (Prunus laurocerasus).

It was entirely by accident that I happened to choose a blackthorn sequence to tweet, but because I did, I was reminded of a little haiku I did for the Science Creative Quarterly a while back:

SLOE GIN INGREDIENTS
a haiku by Karen James

Prunus spinosa
Juniperus communis
Triticum sp.

And that's when the idea hit me: why not take this 'recipe' one step further and make a fun and educational puzzle out of it by leaving the title of the recipe blank and encrypting the ingredients as DNA sequences? And why not do this for a bunch of recipes and make a whole DNA-encrypted recipe book? Here's what my sloe gin recipe might look DNA-encrypted:

The following ingredients make up what alcoholic beverage?

gcacaggctgaaacaggtgaaatcaaagggcattacttgaacgctactgcaggtacatgcgaagagatgatgaa
aagagctgcatttgccagagaattgggggttcctatcgtaatgcatgattacttaacagggggattcactgcaaata
ctaccttggctcattattgccgagataatggtttacttcttcacatccaccgtgcaatgcatgcagttattgatagaca
gaagaatcatggtatgcactttcgtgtactagctaaagcgttacgtatgtctggtggagatcatatacacgctggtac

ggatgtactatcaaaccaaaattgggtctatctgccaagaattatggtagagcggtttatgaatgtctccgtggtgga
cttgattttaccaaggatgatgaaaacgtgaattcccaaccatttatgcgctggagagatcgtttctgcttttgtgcag
aagcactttataaagctcaggctgagacgggtgagattaagggacattacctgaatgcgactgcagggacatgtga
agaaatgatgaaaagagcagtattcgccagagaattgggagttcctatagtcatgcatgactatctgactggaggtt

aagaaatgattaagagagctgtatttgcaagagaattaggggttcctattgtaatgcatgactacttaactggggga
ttcaccgcaaatactactttggctcattattgccgcgacaatggcctacttcttcacattcaccgtgcaatgcatgcagt
tattgatagacagaaaaatcatggtatgcatttccgtgtattagctaaagcattgcgtatgtctgggggagatcatatc
cactccggtacagtagtaggtaagttagaaggggaacgcgaaatgactttaggttttgttgatttattgcgcgatgatt

One could mix it up a bit and use some amino acid sequences too, and for ingredients that are pure products of biochemical pathways (sugar, alcohol, etc.), one could use sequences of genes that function in those pathways.

Lessons would include:

• our food is (or was, or was produced by) living organisms with DNA in them (this is an important lesson - I've heard that children are generally unaware that what they ate for breakfast consisted of plants and animals)
• you can identify species by their DNA
• genes encode proteins, which have functions in the cells of plants and animals
  
• practice using Genbank and BOLD databases

So, what do you think?

I remember*

Sixty-five years ago this morning, the 'largest single-day amphibious invasion of all time' commenced. It was the beginning of the end of Hitler. My heartfelt thanks to the men and women who, without the reassuring benefit of our victory-tinted hindsight, undertook the task.

Portsmouth, England: Veteran Leonard Hackett, 86, takes part in the commemoration services for the 65th anniversary of the D-Day landings. Photograph: Jonathan Brady/Epa.
Source: The Guardian.

*Of course, technically, I don't remember, since I wasn't born yet, and that's the reason it's all the more important that I do remember, and anyways, you know what I mean.

New Darwinius t-shirts

Dear fellow Darwinius hype debunkers, I hope my newest wares will interest you:

Proceeds to The HMS Beagle Trust (UK Charity No. 1126192).

Why Darwinius is not our ancestor

I have been blogging and tweeting the dead horse primate that is Ida Darwinius masillae for several days now, culminating in last night's twitter-fest during the BBC documentary Revealing Our Earliest Ancestor: The Link. During our lively little twitter event, which made the Times Online today, I was, apparently, pretty worked up: Andrew Maynard even wrote 'Warming my toes from the heat of your ire...'.

Of course, it's not only us twitterers bemoaning the Darwinius hype machine; there's going to be a special Darwinius blog carnival on Monday, and I'm pleased to see a growing number of mainstream outlets casting a critical eye over the story, or at least giving space to external critics. For example, today I found an excellent opinion piece by Chris Beard the NewScientist called Why Ida is not the missing link. In it, Beard dresses down not just the hype - "unbridled hoopla" as he called it - but also the science itself. His final paragraphs are particularly good:

'So, Ida is not a "missing link" – at least not between anthropoids and more primitive primates. Further study may reveal her to be a missing link between other species of Eocene adapiforms, but this hardly solidifies her status as the "eighth wonder of the world".

Instead, Ida is a remarkably complete specimen that promises to teach us a great deal about the biology of some of the earliest and least human-like of all known primates, the Eocene adapiforms. For this, we can all celebrate her discovery as a real advance for science.'

Great stuff. Great enough to make me shout "Yes!" out loud while alone in my flat. What Beard is saying here is that Darwinius is not the 'missing link' between anthropoid side of the primate family tree (including humans) and the lemur side because the authors of the paper in which Darwinius is described have not convincingly demonstrated that she belongs with the former and not the latter. Beard contends that the balance of evidence keeps Darwinius - and all the rest of the adapiforms by extention - anchored firmly on the lemur line. To explain this, he provides this useful diagram of primate evolutionary history:

Evolutionary tree diagram reproduced from NewScientist.

The diagram shows the two competing hypotheses: the red dot in the diagram indicates where Chris Beard contends Darwinius belongs, on an early branch in the lemur (brown) lineage. The paler spot with the "?" indicates where the paper's authors claim Darwnius belongs, as an early member of the (blue) anthropoid lineage and, specifically, as they have contended in interviews and on their website if not in their paper, ON the line. In other words, they claim she is our direct ancestor.

I don't have any professional background in primate anatomy but I find Beard's argument - especially in combination with Laelaps' analysis - pretty compelling, certainly compelling enough to remain very skeptical of the authors' conclusions. We will have to wait for further analyses of the Darwinius specimen, however, before this controversy can be more soundly resolved.

But here's the thing: even if upon further analysis Beard is shown to be mistaken and the authors are right about Darwinius and her fellow adapids being on the anthropoid lineage, she will still not necessarily be the 'missing link', nor - perhaps more importantly because it actually means something - 'our ancestor'. To explain my point, I re-drew Beard's diagram:

My re-drawing of Chris Beard's diagram in which I shift his representation of the paper's conclusion about Darwinius' systematic position from ON the anthropoid line to a BRANCH off the anthropoid line.

I re-drew it this way for the simple reason that, considering the abundance of species upon the Earth at any one time, it would be very unusual for us to find a fossil on our direct ancestral line, rather than on a branch off of that line. As John Wilkins put it, "There is no missing link. Rather, there are an indefinite number of missing branches. [snip] We might have a species that is an ancestor of some other species, and yet not know enough to say that they are indeed the ancestor in question."

Additionally, as Richard Carter notes, Ida herself can't be our direct ancestor because she died as a juvenile. But as I've just explained, even her whole species is very unlikely to include our ancestor.

Interestingly, as I mentioned in passing above, the hype machine (including the paper's authors themselves when interviewed) puts Darwinius directly on the line to us, while in Supplementary Figure 7 in the PLoS ONE paper, the authors put Darwinius on a early branch off the line. In other words, what they're saying in public isn't just hyped up, it's fundamentally different from what they're saying in the paper itself.

To summarize, if Darwinius is found, as the authors contend, to belong on 'our' side of the primate family tree (and even that conclusion is shaky) she is not a 'missing link' (because there's no such thing), and she is very unlikley to be our ancestor.

Darwinius has left the building

So there I was earlier today, minding my own business at home (I attached a day of annual leave to the bank holiday weekend in order to take care of a few pressing things like, apparently, writing this blog post), and all the while, over at my workplace, the over-hyped but nevertheless stunningly complete and aesthetically beautiful fossil Darwinius messilae was on display for a few hours on its way from New York to Oslo.

The brief display was occasion for a press conference (or is it the other way around?), but there was also a short time during which staff were invited to view Ida* the fossil. I found out at about 3pm when I stumbled across a BBC News story which led me to an NHM press release:

Visitors to the Natural History Museum in London will be able to see Ida, the fossil of the ancient lemur-like creature, when a cast goes on display from tomorrow.

[snip]

The Ida cast was donated to the Natural History Museum today by the University of Oslo Natural History Museum. Sir David Attenborough will be there to see the cast and is also narrating Uncovering Our Earliest Ancestor: The Link, a one-off documentary about Ida on BBC One at 21.00 tonight.

[snip]

Scientists at the Natural History Museum, London, will get a glimpse of the real specimen when it is brought to the Museum for just a few hours.

The lucky scientists will see the most complete fossil primate ever found. It is so well-preserved that the remains of its last meal are still in its stomach and you can see an outline of where the fur once was.

Upon realizing that "the lucky scientists" might in fact include me, I leapt towards the telephone to call a colleague in the NHM press office to find out how long it would be on display today. Annual leave or no, if there was a chance to see it, I was going to get onto my bicycle and get myself over there pronto!

You can imagine how I felt when my colleague told me that the staff viewing time had ended at 2pm and that the fossil was no longer in the building. Actually, you don't have to imagine how I felt because my disappointment is documented for posterity on twitter (thanks to Rowan and Mun-Keat for the consolatory tweets).

The wave of disappointment that washed over me, though, was quickly followed by introspection. Why was I so disappointed? Had I actually succumbed to the hype? I could tell you (and more importantly, myself) that I was just disappointed not to get to see a beautiful, complete 47-million-year-old primate fossil, but if I'm honest, I have to admit that I also wanted to see the the source of all the commotion and get to feel like an insider. So I did succumb, but more in the way gawkers slow down to look at traffic accidents than in an "OMG THE MISSING LINK" way. Following this analysis, I felt a little less disappointed. Hooray for analysis!

Of course, this doesn't mean that tomorrow morning on my way up to my newish digs in Phase II of the NHM's Darwin Centre I won't stop off and have a look at the cast of Darwinius, which, though not the real thing is still one of maybe only two casts in the world (the other at the AMNH in New York).

But seeing the cast won't quite make up for not seeing the real thing (Rowan Hooper tweets that the cast doesn't quite do the original justice), and I still will have missed the press conference, which would have been interesting because, judging by the BBC video coverage, Jørn Hurum (the most hyperbolic of the scientific authors) and David Attenborough seem to be toning down the hype a little:



Attenborough even says - tellingly - that Darwin "would have been absolutely riveted by it - I have no doubt about that, and he would - I am sure - have sat and looked at it and thought about it - probably for a decade - before he said anything about it. Maybe that's quite a wise thing to do." Might this final sentence signal that David Attenborough feels a twinge of regret about the way the project was handled?

Similarly, Rowan Hooper's blog and video coverage of the event shows Hurum apparently backpedaling a bit in the face of recent criticism that the paper was weak on evolutionary analysis - I can only imagine he's referring to Brian Switek's excellent critques of the scientific paper - by claiming that this only ever meant to be a descriptive paper and that a more rigorous phylogenetic analysis was still in the pipeline.

But there's a problem: as Rowan Hooper writes, "Phylogeny [evolutionary history], he says, is not the most important part of the paper, and is only mentioned in the discussion. But, of course, it is the phylogeny of Ida - and the claims that it is an ancient human ancestor - that have made it such a big news story."

*Like pretty much everyone else, I have been using the nickname "Ida" for Darwinius massilae, but I'm stopping today for three reasons: 1) the ICZN have - at short notice - worked their proverbial tails off to guarantee the nomenclature of this specimen, and calling it "Ida" seems to me to diminish their efforts specifically and the importance of nomenclature generally, 2) I feel a little queasy about how one of the paper's authors, Jørn Hurum, has been fanning the hype, saying things like "this is the first link to all humans" (whatever that means), and he's the one who named the fossil "Ida" so using it feels like an approbation 3) "Darwinius" has a nice ring to it.

Now that's what I'm talkin' about

From the New York Times: Mrs. Obama helped plant a tree on April 21 as part of an event at the Kenilworth Aquatic Gardens in Washington. Photo by Martin H. Simon.

Live-blogging the Darwn-200 Anniversary Conference in Istanbul

Update Saturday 25 April: The conference is now over, so I've removed the twitter widget below and replaced it with the twitter history of the event, that is, my tweets from the conference in order. In a second update I will thread them with replies and retweets from the twitter community. Thanks to everyone in twitterdom who followed and participated!

Background here. This live-blog session will consist consisted of a twitter feed plus longer live (or at least live-ish) updates to this blog post below the twitter widget and will be followed up with a separate post with my thoughts on the conference that I couldn't manipulate into 140 characters or less (which I'm starting to realize is probably the best way to cover a conference since it's too onerous to sit down and compose paragraphs with the conference still in progress).

Test tweet from Turkey!2:50 PM Apr 23rd from txt

Test text tweet two from Turkey!6:48 AM Apr 24th from txt

Okay everyone, the conference is starting now! Just joining in? Wondering what's goin' on in Istanbul? http://tr.im/jAcp http://tr.im/jAcs7:17 AM Apr 24th from Nambu

First talk of the day: Prof. Vidyanand Nanjundiah [Indian Institute of Sciences, Bangalore] ‘The Evolution of Cooperativity’7:18 AM Apr 24th from Nambu

Nanjundiah: "I hope you won't mind if I quote extensively from Darwin" - no, not at all! First quote = the 'problem' of the social insects7:20 AM Apr 24th from Nambu

Nanjundiah: Darwin's four solutions to the problem (to his theory) of the social insects. 4th solution: Descent of Man, Chapter V.7:22 AM Apr 24th from Nambu

@milagro88 It's the Darwin200 Anniversary Conference in Istanbul. Tweeting it now!7:24 AM Apr 24th from Nambu in reply to milagro88

Oh ffs. RT @edyong209 WSJ not accepting comments on blogging=opinions piece. Even after arcane registration process. Hmph. http://ow.ly/3yaO7:26 AM Apr 24th from Nambu

Yes, exactly, Grace! RT @grace_baynes @rpg7twit @kejames except if you want to bring said 120 ml home again and have hand luggage only :-/7:27 AM Apr 24th from Nambu

Nanjundiah: Haldane &'s Wright group selection vs. Williams who said group selection doesn't exist & when it does, it's just individual sel.7:29 AM Apr 24th from Nambu

Nanjundiah: Dictyostelium discoideum and D. giganteum as a model for group selection (if it exists, that is)7:32 AM Apr 24th from Nambu

Nanjundiah: Why do Dicty stalk cells behave altruistically? He's begging the question "what is an organism" & "what is a group"?7:36 AM Apr 24th from Nambu

Nanjundiah: even before the initiation of sociality in Dicty, there are tendencies that hint towards which cells will become sacrificial7:47 AM Apr 24th from Nambu

Nanjundiah: phenotypic plasticity (from stochastic gene expression) suggests 'sociology' > important than kinship in cooperative behaviour7:51 AM Apr 24th from Nambu

Q for Nanjundiah: this has become widely accepted among those who study social insects, so this talk very welcome; 'farewell kin selection'!7:52 AM Apr 24th from Nambu

Darwin200 Istanbul, next up: Prof. Hüseyin Atay [Faculty of Theology, Ankara University] ‘Science, Evolution & the Qu’ran’7:54 AM Apr 24th from Nambu

Atay: "I owe my practice to being non-dogmatic to the Qu'ran"7:56 AM Apr 24th from Nambu

Atay: 'the desire [for God] originates in infancy & continues to death' (I'd say ''from the point of indoctrination' instead of 'infancy')8:00 AM Apr 24th from Nambu

Atay: "from my study of the Qu'ran" & "according to the Qu'ran" but he assumes we think, like he does, that the Qu'ran is a source of truth8:06 AM Apr 24th from Nambu

Atay: "listen to every word" but I can't understand HIS every word (he's reading an English translation of his talk in Turkish)8:09 AM Apr 24th from Nambu

Atay: "whoever argues for his faith should be tested" ...oooh, it's getting good now (the bit I can understand)8:12 AM Apr 24th from Nambu

Atay: "the Qu'ran does not refer to the first creation of other beings" & on origin of man it describes man's origin in developmental terms8:14 AM Apr 24th from Nambu

Atay: "the Qu'ran speaks of science but is not a book of science"; it aims to draw man's attention to (not to instruct in) these things8:16 AM Apr 24th from Nambu

Atay: "the mind is not subject to the Qu'ran" and "reason does not produce knowledge, it makes use of knowledge produced by mind"8:17 AM Apr 24th from Nambu

From Atay's abstract: "Creationists have misunderstood God."8:21 AM Apr 24th from Nambu

Also from Atay's abstract: "Evolutionists attribute awe to evolution; in so doing, they ascribe divine provenance, just as creationists do."8:23 AM Apr 24th from Nambu

Atay: "The mind knows the unknown by using inference."8:24 AM Apr 24th from Nambu

If Dawkins, PZ et al are the "new atheists" then I think Atay is a "new moderate" for saying things like this: (...continued in next tweets)8:28 AM Apr 24th from Nambu

Atay: Creationists say God created everything; then he also created evolutionists, so to criticize evolutionists is to criticize the creator8:31 AM Apr 24th from Nambu

Atay: "Evolutionists say man evolved; since creationists are men, to criticize creationists is to criticize evolution." <--see what I mean?8:33 AM Apr 24th from Nambu

On this last point Atay assumes we are reluctant to criticize evolution. Does he think we adhere still to the great chain of being?8:38 AM Apr 24th from Nambu

Q from a self-professed "former religious fanatic" that I couldn't understand a word of. :(8:41 AM Apr 24th from Nambu

Atay's talk will be published on the conference website and/or in a newspaper, which is good b/c I only understood every 5th sentence or so.9:18 AM Apr 24th from Nambu

Darwin200 Istanbul: Next up: Prof. Francisco Ayala [University of California] ‘The Intelligent Design Movement – a Critique’9:19 AM Apr 24th from Nambu

Ayala: "Darwin's discovery of natural selection provided the main process which accounts for the design of organisms by natural processes"9:20 AM Apr 24th from Nambu

Ayala: "Intelligent design is not science. Even worse, it is bad religion"9:22 AM Apr 24th from Nambu

Ayala: the famous mosaic of images of butterfly wings that make all the letters of the alphabet; doesn't mean they were designed for wri ...9:26 AM Apr 24th from Nambu

Ayala: The Copernican revolution is really a commitment to the idea that laws that explain observable phenomena can be discovered & tested.9:27 AM Apr 24th from Nambu

Ayala: William Payley expressed idea of intelligent design better than modern talking heads, and with much better biological understanding.9:28 AM Apr 24th from Nambu

For anyone just joining - I'm tweeting live from the Darwin200 Anniversary Conference in Istanbul. Background here: http://tr.im/jAA99:31 AM Apr 24th from Nambu

Ayala reading now from The Origin of Species, Chapter IV, Natural Selection, "As more individuals are produced than can possibly survive..."9:32 AM Apr 24th from Nambu

A privilege to hear Ayala explain evolution, natural selection, intelligent design (which he is critiquing, in case that wasn't clear)9:33 AM Apr 24th from Nambu

@TEDchris Thanks for the mention!9:35 AM Apr 24th from Nambu in reply to TEDchris

@USelaine Thanks! FYI @nytimeskristof Tonight's public session is on Turkish TV & attended by journalists including, rumor has it, from NYT9:38 AM Apr 24th from Nambu in reply to USelaine

Ayala now using famous melanic moth example. Though correct, I think this story's effectiveness tainted by bad press (wrong but still bad)9:43 AM Apr 24th from Nambu

Ayala now hammering it home with a detailed explanation of the step-by-step evolution of molluscan and vertebrate eyes. Yesssss!9:46 AM Apr 24th from Nambu

@rpg7twit Unfortunately it's the size of the container, not the amount of liquid remaining.9:49 AM Apr 24th from Nambu in reply to rpg7twit

Ayala: "the vertebrate eye has an imperfection that the molluscan eye doesn't" namely, the blind spot. Heh. Man IS but a worm!9:50 AM Apr 24th from Nambu

Ayala: "I will now criticize the design movement in 2 ways: 1) my own criticisms & 2) those of John Jones (Dover judge)" *sits up straight*9:52 AM Apr 24th from Nambu

Ayala: Philip Johnson (ID proponent) claimed "Give us 5-10 years, and you'll see sci breakthroughs biologists hadn't dreamed of before I ...9:54 AM Apr 24th from Nambu

Ayala: ...well that was 1998!9:55 AM Apr 24th from Nambu

Ayala: "The ID proposal has several probs" (holy understatement, batman!) including "Imperfect Design" e.g. human jaw, human birth canal &c.9:59 AM Apr 24th from Nambu

Ayala! Snap! If God intelligently designed organisms then high rate of human miscarriages implies that "God is the greatest abortionist"10:04 AM Apr 24th from Nambu

Ayala: "Science is methodologically naturalistic not philosophically materialistic."10:05 AM Apr 24th from Nambu

Ayala's final slide: "Evolution: Darwin's gift to religion"10:06 AM Apr 24th from Nambu

Q to Ayala: "Sci & religion are 2 different approaches but are they really compatible?" Ayala: "yes, as it is w/ aesthetics, economics, &c."10:10 AM Apr 24th from Nambu

Ayala's book (for any tweeps interested) is "Darwin's Gift To Science And Religion" Joseph Henry Press, 200710:11 AM Apr 24th from Nambu

Next up: Prof. Aykut Kence [Middle East Technical University, Ankara] ‘Creationism – Historical and Contemporary Perspectives’10:13 AM Apr 24th from Nambu

Kence: "evolution is most controversial theory in history of science not b/c of 'drawbacks' but b/c so many non-scientists can't accept it"10:16 AM Apr 24th from Nambu

Kence now giving us a history of creationism in USA and Turkey (which are, as a poster reminded me, top 2 countries for evolution denial).10:17 AM Apr 24th from Nambu

Kence: "The 'problem' w/ evolution didn't exist at the founding of Republic of Turkey" ergo rejection of Darwinism a recent development.10:26 AM Apr 24th from Nambu

Kence: "In 1970s Fethullah Gulen started giving anti-Darwinism conferences. He said sci textbooks should be written by 'our religious men'"10:27 AM Apr 24th from Nambu

Kence: US creationist talking points were simply adopted and modified to Islam. Specific examples in textbooks show cut-and-paste approach.10:28 AM Apr 24th from Nambu

Now a romp through tragic Turkish textbook quotes e.g. "to give creation to Allah makes things easier/saves scientists from wasting energy"10:35 AM Apr 24th from Nambu

Turkish textbook: "contrary to what evo'ists claim, it was demo'd that frog, mouse & snake blood more similar to human blood than monkeys"10:35 AM Apr 24th from Nambu

Kence: huge amounts of money in Turkey going to defamation of Darwinism. One tactic is 'vilifying evolutionists as Marxists, communists'10:38 AM Apr 24th from Nambu

Kence: younger Turkish teachers less likely to 'believe' in scientific validity of evolution than older Turkish teachers. Awful.10:39 AM Apr 24th from Nambu

Quote from Mustafa Ataturk: "My moral legacy to Turkish people is Science and Reason. The only salvation for Turkey (& middle East!) is ...10:41 AM Apr 24th from Nambu

...to embrace that legacy again. Wow. Powerful.10:41 AM Apr 24th from Nambu

Turkish creos have branded science as "vulgar philosophy"; It appears the Discovery Institute's Wedge doc has been translated into Turkish.10:43 AM Apr 24th from Nambu

Beautifully put! RT @crc2008 faith is personal, all dogma is dogma, science is public acknowledgement of doubt and verification...10:44 AM Apr 24th from Nambu

Now for lunch.10:55 AM Apr 24th from Nambu

Just caught the end of 2pm talk ‘The Challenges of Science Education Today’ by Prof. Nidhal Gessoum [American University of Sharjah, UAE]about 22 hours ago from Nambu

Gessoum: More girls pursuing science in university in Middle East than boys; anecdotal evidence that boys want to go into the Army. Scary.about 22 hours ago from Nambu

Gessoum: What we need most: training and workshops for teachers, and more science endowments and patronage (two words: Beagle Project!)about 22 hours ago from Nambu

Up next: Prof. Sema Ergezen [Marmara University] ‘Teaching Evolution in Turkey: Present and Future’about 22 hours ago from Nambu

Good morning America! If you're just joining in, I am live-tweeting the Darwin200 Anniversary Conference in Istanbul http://tr.im/jBepabout 22 hours ago from Nambu

Ergezen exploring causes & consequences of systemic anti-evolutionism in Turkish teaching. Wow, & to think we thought it was bad in the US.about 22 hours ago from Nambu

Ergezen: Turkish teachers complain of not having had specific courses on evolution at University, or that those courses are superficial.about 22 hours ago from Nambu

Ergezen: Turkish teachers say they don't know how to teach evolution; others don't know how to defend evolution (against creat'ist students)about 22 hours ago from Nambu

62% of 1st year biology students in Ergezen's class "don't accept evolution" i.e. they arrive at school biased against evolution.about 22 hours ago from Nambu

Ergezen: we are failing to help teachers think evolutionarily, and to infuse evolution throughout all biologyabout 22 hours ago from Nambu

@imascientist Why thank you! *blushes* (or is that the Turkish coffee?)about 22 hours ago from Nambu in reply to imascientist

@flascience Thanks, we're hearing now about one of your fave topics: evolution education! Pro development for teachers an important theme..about 22 hours ago from Nambu in reply to flascience

Ergezen: we must 1) create collaborations between scientists and teachers, provide pro. development to teachers, promote evolution-thinkingabout 22 hours ago from Nambu

Ergezen: We must take action! We must start now! A passionate call not to be passive! (*cough* Beagle Project *cough*)about 22 hours ago from Nambu

Welcome to Twitter friend, wordsmith, Yorkshireman & Beagle Proj co-founder Peter McGrath! @pietromcg (a.k.a. the Ben Goldacre of the North)about 21 hours ago from web

THIS IS WHAT CENSORSHIP LOOKS LIKE http://pic.im/1Veabout 21 hours ago from Nambu

Up next: FInal Panel Discussion ‘A Better Vision - The Public Understanding of Evolution in Turkey and Beyond’about 21 hours ago from Nambu

Panel Discussion Chair Prof. Aslı Tolun giving us background on Turkish evolution education & outreach situation. To paraphrase: it's bad.about 21 hours ago from Nambu

Hearing inside scoop from Tolun on the (most recent) Darwin censorship incident http://tr.im/jBxs (aside: even Iran teaches evolution!)about 21 hours ago from Nambu

Tolun asks: why is evolution edu important; what are the major problems; what are the challenges; what are the means for effective teaching?about 21 hours ago from Nambu

Panelists' answers to "why is evolution important": 1) b/c scientists need frameworks to link their findings w/ a context...about 21 hours ago from Nambu

2) nothing in bio makes sense w/o it; 3) b/c it helps us take greater meaning fr. your interactions w/ nature (kids shouldn't be afraid ...about 21 hours ago from Nambu

...of insects!); 4) human health and disease prevention all founded on evolution (<--panelists' answers to 'why evolution important')about 21 hours ago from Nambu

I asked panel: is evolution denial demographically linked to climate change denial in Turkey as it is in USA? ...about 21 hours ago from Nambu

... answer is "No, it's a more general problem of apathy & ignorance. Even those who support evolution do so w/o knowing why; it's ideology"about 21 hours ago from Nambu

Good morning West Coast! If you're just joining in, I am live-tweeting the Darwin200 Anniversary Conference in Istanbul http://tr.im/jBepabout 21 hours ago from Nambu

First-year Turkish university students, presented with an 18-million-year-old fossil and asked to guess how old, will answer 50-200yrs.about 21 hours ago from Nambu

@CR_Fauchald Many at this conference would agree w/ you. Others wouldn't. Sadly all this 'haggling' is hurting our science & our society.about 21 hours ago from Nambu in reply to CR_Fauchald

Turkish panelist informs us that though Turkish academy founded to advise government, it doesn't work that way anymore.about 21 hours ago from Nambu

Another panelist says there is no professional community for science education scholarship in Turkey: there's a lack of associations & unityabout 21 hours ago from Nambu

Solution offered to panelists by audience member: need to boost cultural support for evo; to do this, must know history of their alienationabout 21 hours ago from Nambu

The quality of curricula on evolution is a big problem in Turkey, USA, UK, France; they put too much emphasis on particular bio processesabout 21 hours ago from Nambu

Juxtaposition giving me goosebumps: In session on evolution & religion & can hear the mosque next door to the hotel calling to prayerabout 20 hours ago from Nambu

Great comment from audience: consensus at this conference is that religion & evolution are compatible, but society at large it's 'either/or'about 20 hours ago from Nambu

Panelist: "evolution has been used as an ideological battleground; teaching evolution is not about converting people, it's about explaining"about 20 hours ago from Nambu

Comment: getting the mullahs to tell their followers to accept evolution is NOT the point; the point is to inspire critical thinking.about 20 hours ago from Nambu

@crc2008 First of all, I said "evolution and religion are compatible" is the consensus of this conference, not necessarily my own view!about 20 hours ago from Nambu in reply to crc2008

@crc2008 Second of all, I would have like to have said 'acceptance of evolution' not just 'evolution' but such is twitter ;-)about 20 hours ago from Nambu in reply to crc2008

Only when the religious stop meddling w/ sci edu! RT @tuibguy teach the biology let the religious worry about their part. Will it work?about 20 hours ago from Nambu

Commenter: better science education is needed in the seminaries. (Yep, that'd be good, I agree. Good luck though.)about 20 hours ago from Nambu

@mwinther @rdmpage @neuro100 Heh. Unfortunately all of the spokesmen for this view (Dawkins et al.) were specifically *not* invited here.about 20 hours ago from Nambu in reply to mwinther

OMG this is scary. Someone is standing up and saying 'the problem is democracy' because culture is king in democracy.about 20 hours ago from Nambu

Double OMG! He called Dawkins "an extreme vulgar ideologist"! ...then said people need to be persuaded not forced to accept evolution. Hmm.about 20 hours ago from Nambu

Me: In all our talk about the education-ignorance dichotomy & how to argue better, let's not forget about the apathy-inspiration dichotomyabout 20 hours ago from Nambu

Phew! My talk is over and now enjoying a production of Re-design, a dramatization of the Darwin-Gray correspondence.about 17 hours ago from txt

This is the public portion of the symposium w/ 300+ Turkish students in attendance. Next up a televised panel discussionabout 17 hours ago from txt

Still tweeting live from Darwin200 Istanbul though less frequently b/c by text. Televised panel discussion beginning!about 15 hours ago from txt

Audience questions!about 15 hours ago from txt

One questioner practically reading out of Hurun Yahya; he just won't accept the existence of transitional fossilsabout 15 hours ago from txt

Panelist: Science uses hypothesis & experiment to find out truth. Religion uses... uh... something else.about 14 hours ago from txt

@pseudonymTrevor Love that Thoreau is your avatar (*follows*). Glad you found DCP. Darwin-Online is also good resource http://tr.im/jG5Uabout 1 hour ago from Nambu in reply to pseudonymTrevor

Damn, missed my chance. RT @pietromcg Harun Yahya sounds like he's doing a pavement pizza in a shop door after 7 pints & a curry. Tell him.about 1 hour ago from Nambu

Thanks to all who replied to & RT'd my live tweets from Darwin200 Conference in Istanbul. Conf over now, but I'm in Istanbul through Monday.about 1 hour ago from Nambu